Вирусы‎ > ‎

ТОРС атипичная пневмония

С.В. Нетёсов, В.М. Блинов, Т.Ю. Иванькина, Г.М. Игнатьев, М.И. Кисурина, Г.Г. Онищенко, Л.С. Сандахчиев. Тяжёлый острый респираторный синдром (ТОРС), вызываемый коронавирусом // Опубликовано на сайте Госсанэпиднадзора Министерства здравоохранения Российской Федерации 20.05.2003.

МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РОССИЙСКОЙ ФЕДЕРАЦИИ

Тяжёлый острый респираторный синдром (ТОРС), вызываемый коронавирусом.

Литературный обзор.

(Опубликовано на сайте Госсанэпиднадзора Министерства здравоохранения Российской Федерации 20.05.2003)

С.В. Нетёсов, В.М. Блинов, Т.Ю. Иванькина, Г.М. Игнатьев, М.И. Кисурина, Г.Г. Онищенко, Л.С. Сандахчиев.

Введение.

Заболевание «атипичная пневмония» или тяжёлый острый респираторный синдром (ТОРС) или Severe Acute Respiratory Syndrome (SARS) является вновь выявленным заболеванием, которое впервые возникло в китайской провинции Гуандун, в середине ноября 2002 года и было первоначально описано доктором Карло Урбани в Гонконге. К настоящему времени по данным ВОЗ больные атипичной пневмонией зарегистрированы в 28 странах мира. При этом общее число заболевших на 17 мая 2003 года составило 7761 человек, в том числе 623 смертельных исхода. Заболевание зарегистрировано в 32 странах, наибольшее количество в Китае, Сингапуре, Канаде.

Рис.1 Эпидемическая кривая возможных случаев SARS с 1 января по 22 апреля 2003 года по дате начала болезни [2]

17 марта 2003 года ВОЗ была объявлена «глобальная тревога» в связи с распространением «атипичной пневмонии». Были привлечены 13 лабораторий из 9 стран для проведения объединённых исследований этого заболевания. В качестве приоритетных задач ставилось определение этиологического агента, и затем на основании этого – разработка диагностических тест систем. В результате тесного сотрудничества ученых из лабораторий разных стран первая часть поставленной задачи была выполнена поразительно быстро. 16 апреля 2003 года ВОЗ было объявлено, что этиологическим агентом «атипичной пневмонии» является новый патоген, вирус SARS относящийся к семейству коронавирусов, но не родственный ни одному из известных штаммов этого вируса [3]. Однако, начатые работы по диагностике возбудителя выявили несоответствия между результатами, полученными Канадской национальной микробиологической лабораторией и Гонконгской группой исследователей. Так по данным последних в 90 % вероятных случаев ТОРС (SARS) присутствовал SARS-связанный коронавирус, при отсутствии его следов у здоровых лиц контрольной группы. Ни одна из проб секрета дыхательных путей, взятых от пациентов с другими респираторными заболеваниями, не содержала РНК коронавируса, и ни один из 200 образцов сывороток, взятых от доноров крови, не содержал сывороточных антител к этому новому коронавирусу [4]. Напротив, по данным канадской группы SARS-связанный коронавирус выявлялся приблизительно у 20 % из 250 человек без подозрения на ТОРС (SARS), которые, были протестированы, так как они приехали в Канаду из зараженных областей Азии или имели незначительные симптомы, которые не считались симптомами ТОРС (SARS) (т.е. слегка смещенная контрольная группа) [5]. Необходимо срочно объяснить это несоответствие, так как оно ставит под вопрос чувствительность, специфичность и уместность применяемых диагностических тестов. Хотя, конечно же, вирусов, вызывающих острую пневмонию, известно не так уж мало: это и РСВ, и хантавирусы, и аденовирусы. Возбудителями пневмонии могут быть также грибы и бактерии, а, кроме того, в разных странах роль этих возбудителей в этиологии ТОРС может быть разной.

Классификация инфекционного агента.

В состав семейства Коронавирусов входят род Коронавирусы и род Торовирусы. Род Коронавирусы объединяет большие, оболочечные, позитивные одноцепочечные РНК-содержащие вирусы, которые вызывают широко распространенные заболевания человека и животных. Его представители могут быть выделены в три серологические подгруппы (Таблица 2). Внутри каждой серогруппы вирусы классифицированы согласно их естественным хозяевам, нуклеотидным последовательностям и серологическим взаимосвязям [6].

Серотипы и хозяева коронавирусов.

Антигенная группа

Вирус

Хозяин

1

Human coronavirus 229E (HcoV-229E)

Porcine Transmissible gastroenteritis virus (TGEV)

Porcine respiratory coronavirus (PRCoV)

Canine Coronavirus (CcoV) Feline enteric coronavirus (FECoV)

Feline infectious peritonitis virus (FIPV)

Rabbit coronavirus (RbCoV)

Человек

Свиньи

Свиньи

Собаки

Кошки

Кошки

Кролики

2

Human coronavirus OC43 (HcoV- OC43)

Murine hepatitis virus (MHV)

Sialodacryoadenitis virus (SDAV)

Porcine hemagglutinating encephalomyelitis (HEV)

Bovine coronavirus (BcoV)

Turkey coronavirus (TcoV)

Человек

Мыши

Крысы

Свиньи

Крупный рогатый скот

Индюки

3

Avian infectious bronchitis virus (IBV)

Turkey coronavirus (TcoV)

Курицы

Индюки

Коронавирусы имеют самый большой геном из всех РНК вирусов, и рекомбинация у них выявлялась нередко. В настоящее время расшифрованы полные последовательности геномов некоторых коронавирусов - HcoV-229E; MHV; BcoV; IBV Размер их РНК колеблется от 27000 до 32000 нуклеотидных пар [7].

Секвенирование генетического материала коронавируса, выделенного у больных ТОРС (SARS), было впервые проведено одновременно и независимо в лабораториях американских Центров по контролю и профилактике заболеваний (CDC) и канадского «Vanderbild University Medical Center». По полученным данным размер генома возбудителя ТОРС (SARS) составляет 29727 п.о. и 29736 п.о. соответственно [89].

Также получены данные по секвенированию нескольких изолятов вируса SARS китайскими исследователями (Institute of Microbiology and Epidemiology of the Academy of Military Medical Sciences and the Beijing Genomics Institute of Chinese Academy of Sciences) [10]. Сравнение последовательностей этих изолятов с данными, представленными американскими и канадскими учеными, позволяет предположить, что вирус может быстро мутировать [11].

По мнению исследователей из Bernard Nocht Institute of Tropical Medicine в Гамбурге, вирус ТОРС (SARS) по нуклеотидным последовательностям отличается на 50-60 % от трёх известных групп коронавирусов, но, несомненно, является типичной вариацией среди существующих групп 2 и 3 коронавирусов [12].

Филогенетический анализ, проведенный различными исследователями на основании сравнения нуклеотидных и аминокислотных последовательностей участков гена полимеразы, представлен на рисунках 23.

Рис. 2. Филогенетическое дерево с максимально возможной достоверностью, построенное на основе выравненных последовательностей 405 нуклеотидов открытой рамки считывания 1b гена полимеразы коронавируса (номера нуклеотидов с 15173 по 15578 на основе полного генома коронавируса крупного рогатого скота инвентарный номер NC_003045), для сравнения коронавируса SARS с другими коронавирусами человека и животных.

На дереве видны три основные антигенные группы в Роду коронавирусов (I, II и III), представленные человеческим коронавирусом 229E (HcoV-229E), собачьим коронавирусом (CcoV), вирусом инфекционного кошачьего перитонита (FIPV), вирусом инфекционного гастроэнтерита свиней (TGEV), вирусом эпидемической диареи свиней (TGEV), человеческим коронавирусом OC43 (HcoV-OC43), коронавирусом крупного рогатого скота (BcoV), гемагглютинирующим вирусом энцефаломиелита свиней (HEV), вирусом крысиного сиалодакриоаденита (SDAV), вирусом гепатита мышей (MHV), коронавирусом индюков (TcoV) и вирусом инфекционного бронхита птиц (IBV). Значения бутстрепов для автоматической компенсации погрешностей (на основе 100 повторов), полученные из дерева консенсуса на основе 50 % принципа большинства, показаны на основных внутренних ветвях филограммы. Длины ветвей пропорциональны количеству нуклеотидных замен.[13]

Рисунок 3. Филогенетический анализ частичной белковой последовательности (215 аминокислот) коронавируса SARS [14].

Cравнение полных геномов коронавирусов не позволяет выявить наиболее близкий к вирусу SARS геном, хотя наибольшее число совпадающих линий наблюдается между SARS и бычьим коронавирусом 2-ого типа (рис. 4). Поэтому эволюционные сравнения необходимо проводить по кластерам генов (рис. 5-7). Хотя и здесь разбиение на кластеры также сопряжено с трудностями. В некоторых участках генома вируса SARS наблюдается наибольшее сходство с бычьим коронавирусом, в других участках генома вируса SARS, наоборот, сходство между птичьим коронавирусом и вирусом SARS выше. Правда, при этом степень гомологии очень низка со всеми известными коронавирусами. Блочный тип эволюции (и возможные точки рекомбинации) можно просчитать более точно, но для этого необходимо время и информация по структуре большего числа штаммов коронавирусов.

Ниже приводится сравнение аминокислотных последовательностей генов полимеразы (POL), матриксного (M) и оболочечного (VGL) белков; для других белков выравнивать последовательности практически невозможно, поскольку сходство между ними меньше 20 %. Для двух известных короновирусов человека (штамм 229E и OC43)- ситуация уникальная: наиболее близкий к вирусу SARS штамм OC43 (но для этого штамма нет полной структуры генома), а штамм 229E настолько не похож на вирус SARS, что говорить о каком-то сходстве вообще нельзя. С одной стороны имеется группа короновирусов (бычий/мышиный/человеческий OC43), с другой стороны группа (свиной/кошачий/собачий/человеческий 229E) и наконец группа (птичьи) и все эти три группы равноудалены от вируса SARS. Говорить о блочной рекомбинационной природе агента SARS пока можно только для мышиных коронавирусов, для которых известны структуры 6 полных геномов, для них существуют, по крайней мере, четыре точки рекомбинации в одном геноме. Для остальных коронавирусов такой информации пока нет.

Как видно из приведенных на рис.4 матриц сравнения и филогенетических деревьев, возбудитель SARS (ТОРС) наиболее близок к бычьему коронавирусу. Известно, что так называемые «бычьи» вирусы, как правило, оказываются также и вирусами мелких грызунов и даже кошек, живущих вместе или рядов с коровами. Поэтому гипотеза о кошачьей природе возбудителя ТОРС (SARS) имеет законные права на существование.

число совпадающих линий

1.

bov-ent

52

Bovine coronavirus (isolate BCoV-ENT)

2.

mhv-2

46

Murine hepatitis virus (strain 2)

3.

mhv-ml1

46

Murine hepatitis virus (strain ML-11)

4.

mhv-ml0

46

Murine hepatitis virus (strain ML-10)

5.

mhv-a59

45

Murine coronavirus MHV (strain A59)

6.

mhv-pen

44

Murine hepatitis virus (strain Penn 97-1)

7.

por-pur

44

Porcine transmissible gastroenteritis (strain Purdue)

8.

por-cv

41

Porcine epidemic diarrhea virus (strain CV777)

9.

hum-229

40

Human coronavirus (strain 229E)

10.

avi-bea

33

Avian infectious bronchitis virus (strain Beaudette)

Рис. 4. Матрица сравнения полного генома вируса SARS c геномами других коронавирусов другими коронавирусами


 

Степень подобия (%):

 

POL

gene

%

 

1.

sars

100.00

 

2.

bov-ent

60.87

Bovine coronavirus /isolate=«BCoV-ENT»

3.

mhv-a59

60.58

Murine coronavirus MHV (strain A59)

4.

mhv-2

60.47

Murine hepatitis virus (strain 2)

5.

mhv-ml1

60.47

Murine hepatitis virus (strain ML-11)

6.

mhv-ml0

60.40

Murine hepatitis virus (strain ML-10)

7.

mhv-pen

60.25

Murine hepatitis virus (strain Penn 97-1)

8.

mhv-jhm

59.85

Murine coronavirus MHV (strain JHM)

9.

por-cv

55.12

Porcine epidemic diarrhea virus /strain=«CV777»

10.

por-pur

54.51

Porcine transmissible gastroenteritis (Purdue)

11.

hum-229

54.47

Human coronavirus (strain 229E)

12.

avi-bea

53.75

Avian infectious bronchitis virus /Beaudette

 

Усредненная степень подобия: 67.95 %

Рис. 5. Матрица сравнения POL гена вируса SARS c геномами других коронавирусов


 

Степень подобия (%):

 

M

gene

%

 

1.

bov-ent

39.57

Bovine coronavirus /isolate=«BCoV-ENT»

2.

VME1_CVBM

39.13

Bovine coronavirus (strain Mebus)

3.

VME1_CVTKE

38.70

Turkey enteric coronavirus (TCV)

4.

VME1_CVHOC

38.70

Human coronavirus (strain OC43)

5.

VME1_CVMA5

37.12

Murine coronavirus MHV (strain A59)

6.

mhv-2

37.12

Murine hepatitis virus (strain 2)

7.

VME1_CVMJH

36.68

Murine coronavirus MHV (strain JHM)

8.

por-cv

30.84

Porcine epidemic diarrhea virus /strain=«CV777»

9.

VME1_CVH22

27.31

Human coronavirus (strain 229E)

10.

VME1_IBVK

26.87

Avian infectious bronchitis virus (strain KB8523)

11.

VME1_IBV6

26.43

Avian infectious bronchitis virus (strain 6/82)

12.

VME1_IBVB

25.99

Avian infectious bronchitis virus (strain Beaudette)

13.

VME1_IBVB2

25.99

Avian infectious bronchitis virus (Beaudette M42)

14.

VME1_CVPRM

24.81

Porcine respiratory coronavirus (strain RM4)

15.

VGL1_CVPR8

24.43

Porcine respiratory coronavirus (strain 86/137004)

16.

VME1_CVPFS

24.43

Porcine transmissible gastroenteritis (FS772/70)

17.

VME1_CVPPU

24.43

Porcine transmissible gastroenteritis (strain Purdue)

18.

VME1_FIPV

24.05

Feline infectious peritonitis virus (strain 79-1146)

19.

VME1_CVCAI

23.28

Canine enteric coronavirus (strain Insavc-1)

 

Усредненная степень подобия : 42.76 %

Рис. 6. Матрица сравнения M гена вируса SARS c геномами других коронавирусов


 

Степень подобия (%):

 

VGL

gene

%

 

1.

VGL2_CVMJH

23.82

Murine coronavirus MHV (strain JHM)

2.

VGL2_CVHOC

23.19

Human coronavirus (strain OC43)

3.

VGL2_CVBLY

23.13

Bovine coronavirus (strain LY-138)

4.

VGL2_CVBV

23.06

Bovine coronavirus (strain vaccine)

5.

VGL2_CVBL9

22.99

Bovine coronavirus (strain L9)

6.

VGL2_CVBM

22.92

Bovine coronavirus (strain Mebus)

7.

VGL2_CVBQ

22.84

Bovine coronavirus (strain Quebec)

8.

VGL2_CVM4

22.81

Murine coronavirus MHV (strain wild type 4)

9.

VGL2_CVMJC

22.81

Murine coronavirus MHV (strain JHMV/variant CL-2)

10.

VGL2_CVMA5

22.75

Murine coronavirus MHV (strain A59)

11.

VGL2_IBVK

17.40

Avian infectious bronchitis virus (strain KB8523)

12.

VGL2_IBVM

16.93

Avian infectious bronchitis virus (strain M41)

13.

VGL2_IBVB

16.77

Avian infectious bronchitis virus (strain Beaudette)

14.

VGL2_CVH22

16.26

Human coronavirus (strain 229E)

15.

VGL2_CVPRM

15.78

Porcine respiratory coronavirus (strain RM4)

16.

VGL2_CVPR8

15.70

Porcine respiratory coronavirus (strain 86/137004)

17.

VGL2_CVCAI

14.93

Canine enteric coronavirus (strain Insavc-1)

18.

VGL2_CVPMI

14.63

Porcine transmissible gastroenteritis (strain Miller )

19.

VGL2_FIPV

14.60

Feline infectious peritonitis virus (strain 79-1146)

20.

VGL2_CVPFS

14.56

Porcine transmissible gastroenteritis (strain FS772/70)

21.

VGL2_CVPPU

14.42

Porcine transmissible gastroenteritis (strain Purdue)

22.

VGL2_CVPPR

14.35

Porcine transmissible gastroenteritis (Pur46-MAD)

23.

VGL2_CVPRT

14.29

Porcine transmissible gastroenteritis (strain NEB72-rt)

Рис. 7. Матрица сравнения VGL гена вируса SARS c геномами других коронавирусов.


При доказательстве этиологической роли коронавируса SARS, как возбудителя «атипичной пневмонии» все исследования в 13 лабораториях проводились с учетом постулатов Коха: возбудитель должен обнаруживаться у всех больных с данным заболеванием; он должен быть выделен из хозяина и культивирован в чистой культуре; и культура выделенная таким образом должна воспроизводить болезнь у других организмов, с подъемом уровня специфических антител после заражения.

Как удалось в настоящее время выяснить, коронавирусы были обнаружены у более чем 50 % больных, значительная часть изолятов была культивирована в чистой культуре, у больных с выявленным агентом ТОРС был обнаружен подъем антител, и заражение обезьян этим возбудителем дало клиническую картину, характерную для ТОРС [5].

Клиника и лечение «атипичной пневмонии».

С момента возникновения «атипичной пневмонии» уже собрано много материала, который позволяет представить клиническую картину этого заболевания. В совместной публикации ВОЗ, СDC и Health Canada были суммированы данные историй болезни пациентов с диагнозом ТОРС (SARS) начиная с середины февраля 2003 [15].

26 марта ВОЗ были опубликованы результаты проведения виртуального круглого стола, в котором участвовали 80 клиницистов из 13 стран занимающихся исследованием «атипичной пневмонии» [16].

По мнению специалистов, клиническая картина ТОРС(SARS) выглядит следующим образом.

Большинство зарегистрированных больных «атипичной пневмонией» - люди в возрасте 25-70 лет. Несколько случаев заболевания отмечено у детей до 15 лет.

Инкубационный период обычно 2-7 дней; однако в отдельных случаях может достигать 10 дней.

Клинические признаки в начале заболевания неспецифические. Начало болезни в подавляющем большинстве случаев характеризуется высокой температурой > 38° С, сопровождающейся ознобом, миалгией, головными болями и сухим кашлем. Сыпь, неврологические или желудочно-кишечные признаки обычно отсутствуют, однако в некоторых случаях отмечалась диарея в начальном периоде во время лихорадочного состояния.

Через 3-7 дней наступает стадия, связанная с поражением нижних дыхательных путей и появлением характерного сухого кашля, одышки, которая может сопровождаться прогрессирующей гипоксимией. На этой стадии больные разделяются на две группы. У большинства, 80-90 % заболевших, в течение последующих 6-7 дней наблюдается улучшение состояния и симптоматики. Во второй, меньшей группе проявляется более тяжелая форма «атипичной пневмонии» у многих пациентов развивается острый респираторный дистресс синдром и требуется искусственная вентиляция лёгких. Смертность во второй группе высока, и может быть связана с наличием у больных, кроме ТОРС, других заболеваний. Характерные изменения на рентгеновских снимках лёгких могут отмечаться уже через 3-4 дня после появления первых симптомов заболевания, но в некоторых случаях рентгеновские снимки могут оставаться нормальными в течение первой недели и даже всего заболевания.

При прогрессировании болезни рентгенологические исследования показывают у большинства больных двусторонние изменения в виде внутритканевых инфильтратов (жидкость накапливается между клетками в лёгких), которые развиваются в более генерализованные образования. Эти инфильтраты дают на рентгеновских снимках специфическую картину лёгких, испещренных пятнами.

Лабораторные тесты часто показывают лимфопению, среднюю тромбоцитопению и повышенный уровень печеночных ферментов.

В качестве индикатора прогноза развития заболевания выделяют возраст - у больных старше 40 лет большая вероятность развития тяжелой формы заболевания [17].

При отсутствии диагностических тест систем на ТОРС (SARS), и сложности дифференцированной диагностики атипичной пневмонии в начале заболевания, в CDC были разработаны критерии для выявления подозрительных и предполагаемых случаев.

К «подозрительным случаям» следует относить респираторные заболевания неизвестной этиологии и соответствующие следующим критериям:

· Повышение температуры выше 38° С

· Наличие одного или более клинических признаков респираторного заболевания (кашель, учащенное или затрудненное дыхание, гипоксия)

· Путешествие в течение 10 дней в пораженные SARS районы мира или общение с больными подозрительными по данной болезни.

При выявлении «предполагаемых» случаев следует учитывать такие критерии как:

· Подтверждение пневмонии на рентгеновских снимках или респираторный дистресс синдром

· Данные аутопсии, соответствующие респираторному дистресс синдрому без идентифицируемых причин [18].

В настоящее время пока нет эффективных методов борьбы с «атипичной пневмонией». Этиологическая терапия не существует, как и для подавляющего большинства вирусных заболеваний. В материалах ВОЗ и CDC рекомендуется включение с первых дней заболевания в схемы лечения нескольких антибиотиков для предотвращения угрозы развития бактериальной инфекции. В практике предпочтение отдавалось антибиотикам широкого спектра действия - ß-лактамам, фторхинолонам, цефалоспоринам, тетрациклинам.

Кстати, очень неплохие результаты были получены нашими учеными при использовании тетрациклина для лечения вирусного клещевого энцефалита, что отчасти связано с его иммуномодулирующими свойствами. Это позволяет предположить, что препарат может рассматриваться и испытываться, как потенциальное средство в терапии ТОРС (SARS) [19].

В качестве основного противовирусного препарата для лечения ТОРС (SARS) наиболее широко врачами в очагах заболевания используется рибавирин, один или в сочетании со стероидными препаратами. Показано, что он обладает противовирусной активностью, в том числе и по отношению к коронавирусам. Однако, некоторые исследователи высказывают критическое отношение к применению этого препарата, отмечая случаи ухудшения состояния больных при его приёме, хотя давно известны негативные побочные эффекты этого препарата [17]. В отсутствие контролируемых испытаний препаратов, у CDC в настоящее время нет четких рекомендаций как о возможности использования рибавирина и путях его введения (внутрь, внутривенно и/или в виде аэрозоля), так и о необходимости терапии гликокортикоидами [20].

Видимо, применение интерферона и других препаратов этой группы в первые три дня должно снижать тяжесть заболевания, хотя это также требует доказательства.

Таким образом, на настоящий момент терапия ТОРС (SARS) является главным образом патогенетической и симптоматической.

В начале апреля в газетах появились сообщения об использовании гонконгскими врачами в качестве лекарственного препарата против вируса SARS плазмы крови пациентов, благополучно перенесших инфекцию. Врачи из Госпиталя Принца Уэльского (Гонконг) с помощью переливания плазмы крови переболевших людей больным смогли спасти жизни как минимум 20 больных, находившихся до переливания плазмы в критическом состоянии [21]. К сожалению пока не найдено других источников, более подробно описывающих этот опыт.

Диагностика SARS.

Сложная ситуация, обусловленная недавним появлением и быстрым распространением по всему миру ТОРС (SARS), побудила исследователей различных стран направить свои усилия на разработку быстрых и точных лабораторных методов диагностики этого возбудителя. Однако разработка диагностических тестов для этого заболевания продемонстрировала большую проблематичность, чем ожидалось.

В настоящее время ряд диагностикумов разработан, и они уже использовались в разных странах для идентификации возбудителя этого заболевания. Однако, по мнению ВОЗ, до тех пор, пока эти тесты не пройдут соответствующие полевые испытания, и их надежность не будет доказана, диагностика ТОРС (SARS) будет продолжать зависеть от клинических данных, подтверждающих, что атипическая пневмония не вызвана какой-либо другой причиной и контактом с пациентом, предположительно или вероятно больного SARS, или с выделениями из его респираторного тракта и других физиологических жидкостей. Это требование отражено в современном определении предполагаемого и вероятного случая ТОРС (SARS), данном ВОЗ [22] Тем не менее, в некоторых странах (Канада, Франция, Германия, Гонконг, Япония, Нидерланды, Сингапур, Великобритания и США) с помощью этих тестов в экспериментальных условиях исследуются образцы предполагаемых или вероятных больных SARS.

По мнению ВОЗ, при интерпретации результатов тестов следует учитывать ряд моментов. Позитивные результаты теста показывают, что ТОРС (SARS) пациенты являются, или недавно были инфицированы SARS вирусом. В данном случае необходимо установить специфичность различных тестов.

Негативные результаты теста на SARS вирус не должны быть утверждением, что пациент не имеет SARS вируса. Причинами для негативных результатов у пациентов с ТОРС (SARS) может быть следующее:

- Пациент не инфицирован SARS вирусом; заболевание вызывается другим инфекционным агентом (вирусом, бактерией, грибами) или неинфекционной причиной.

- Некорректные результаты теста («false-negative»). Используемый тест необходимо дальше доработать для улучшения его чувствительности.

- Образцы не были собраны в то время, когда вирус или его генетический материал присутствовал (при использовании метода RT-PCR или культур клеток). Вирус и его генетический материал может присутствовать в человеке очень короткий промежуток времени, в зависимости от типа тестируемого образца.

- Образцы были собраны до развития заболевания и до того момента, как стали нарабатываться антитела (относится к ELISA и иммунофлюоресцентному анализам).

Для улучшения понимания процесса ТОРС (SARS) заболевания ВОЗ рекомендует клиницистам проводить последовательный сбор образцов от пациентов с ТОРС (SARS) и сохранять их для тестирования до того момента, когда станут доступными диагностические тесты. Это особенно важно для первичного случая, который выявляется в стране ранее не докладывавшей о ТОРС (SARS) заболевании. Рекомендации по сбору и транспортировке образцов можно найти на web-сайте CDC (США) [23].

Согласно рекомендациям ВОЗ, имеется ряд лабораторных тестов, с помощью которых можно выявить, какой вирус является причиной заболевания у человека, и в настоящее время они апробируются при диагностике ТОРС (SARS). Однако все эти тесты имеют определенные ограничения для использования в случае контролировании ситуации с ТОРС (SARS).

1. Тестирование антител.

Тестирование антител проводится методами ELISA или IFA. Метод ELISA достоверно выявляет антитела в сыворотке ТОРС (SARS) пациентов, начиная с 21-го дня после появления клинических симптомов заболевания. Следовательно, этот тест не может быть использован для выявления вирусов на ранней стадии инфекции, до того, как вирус может распространить инфекцию от одного человека к другому. Иммунофлюоресцентный метод выявляет антитела в сыворотке пациентов через десять дней после появления клинических симптомов и заболевания. Однако этот метод требует наработки в клеточной культуре SARS вируса, проведение работ в противочумной лаборатории или лаборатории BSL-3 уровня иммунофлюоресцентный микроскоп и опытного микроскописта, на что уйдет 2-4 дня.

2. Молекулярные тесты (PCR).

ОТ-ПЦР-тест позволяет выявлять генетический материал SARS-вируса из различных образцов пациента (крови, стуле, респираторных секретов или тканевых жидкостей) и на очень ранних стадиях инфекции. Более того, праймеры, которые являются ключевыми для PCR-теста, сейчас сделаны доступными сетью лабораторий ВОЗ на web сайте ВОЗ и уже используются лабораториями многих стран по всему миру. Существующие ПЦР-тесты являются весьма специфичными, но они пока что недостаточно чувствительны и дают много ложноотрицательных результатов, по которым нельзя исключить наличие SARS-вируса у пациента. Сеть лабораторий ВОЗ работает над своими протоколами и праймерами, чтобы улучшить их достоверность и надежность [23].

Разработаны и предложены 7 праймеров - нуклеотидных фрагментов, с помощью которых можно выявить геном коронавируса, предположительно ответственного за ТОРС (SARS), которые уже используются различными лабораториями ВОЗ для амплификации полимеразного гена коронавирусов. Они в настоящее время исследуются на сравнительную воспроизводимость и чувствительность в различных образцах с различным временем взятия пробы по ходу заболевания. Предполагается публикация результатов и рекомендаций по их использованию по мере их доступности. Позитивные контроли могут быть бесплатно получены на интернет-сайте Bernard Nocht Institute of Tropical Medicine в Гамбурге (Германия).

Результаты PCR, использующие эти праймеры, могут быть использованы в качестве дополнительной клинической оценки. Однако тесты не утверждены лицензионнно на подтверждение или исключение случаев заболевания.

В настоящее время для диагностики ТОРС (SARS) на сайте ВОЗ различными исследовательскими центрами представлены следующие данные по праймерам, которые могут быть использованы в PCR-диагностикумах.

1. Bernhard-Nocht Institute (Bernhard-Nocht Str. 74 D-20359 Hamburg , Germany ).

BNIoutS/BNoutAs: sense ATGAAT TAC CAA GTC AAT GGT TAC

antisense CAT AAC CAG TCG GTA CAG CTA C

FraGment lenGth 195 bp

BNIinS/BNIAs: sense GAA GCT ATT CGT CAC GTT CG

antisense CTGTAGAAA ATC CTA GCT GGA G

Fragment length 110 bp

SAR1s/SAR1as: sense CCT CTC TTG TTC TTG CTC GCA

antisense TAT AGT GAG CCG CCA CAC ATG

Fragment length 150 bp

Amplicon sequence (BNI-1, Bernhard-Nocht Institute, Hamburg , Germany )

TACCGTAGACTCATCTCTATGATGGGTTTCAAAATGAATTACCA

AGTCAATGGTTACCCTAATATGTTTATCACCCGCGAAGAAGCTAT

TCGTCACGTTCGTGCGTGGATTGGCTTTGATGTAGAGGGCTGTCAT

GCAACTAGAGATGCTGTGGGTACTAACCTACCTCTCCAGCTAGGA

TTTTCTACAGGTGTTAACTTAGTAGCTGTACCGACTGGTTATGTTGA

CACTGAAAATAACACAGAATTCACCAGAGTTAATGCAAAACCTCC

ACCAGGTGACCAGTTTAAACATCTTATACC

2. Centers for Disease Control & Prevention (National Centers for Infectious Diseases,

Atlanta GA 30333 1600 Clifton Road, NE, MS-C12 United States )

SARS-specific primers:

Cor-p-F2 (+) 5'CTAACATGCTTAGGATAATGG 3',

Cor-p-F3 (+) 5'GCCTCTCTTGTTCTTGCTCGC 3',

Cor-p-R1 (-) 5'CAGGTAAGCGTAAAACTCATC 3',

Product size:

Cor-p-F2/Cor-p-R1 :368 bp

Cor-p-F3/Cor-p-R1 :348 bp

3. Government Virus Unit 9/F Public Health Laboratory Centre ( 382 NAm Cheong Street Shek Kip Mei Kowloon , Hong Kong SAR Hong Kong - SAR China )

COR-1,COR-2: sense 5' CAC CGT TTC TAC AGG TTA GCT AAC GA 3'

antisense 5' AAA TGT TTA CGC AGG TAA GCG TAA AA 3'

Product size: 310 bp

4. Queen  Mary  Hospital  (The University of Hong Kong University Pathology Building Hong Kong - SAR China )

HKU: sense 5' TACACACCTCAGCGTTG 3'

antisense 5' CACGAACGTGACGAAT 3'

Product size 182 bps [23]

Лабораториям, занимающимся ТОРС (SARS) специфическими PCR-тестами, ВОЗ рекомендует принимать на вооружение качественные контрольные процедуры и объединить свои усилия, как внутри своей страны, так и с исследовательскими лабораториями ВОЗ, с целью перепроверки положительных результатов и использования положительного опыта.

3. Культура клеток.

Вирус в образцах ТОРС (SARS) пациентов (респираторные секреты, кровь и стул) может быть также выявлен при помощи инфицирования культур клеток и последующей наработки вируса. Выделенный вирус может быть идентифицирован как SARS вирус дополнительными тестами. Культура клеток является очень требовательным методом, однако в то же время и единственным способом показать наличие живого вируса [2425].

По сообщениям газеты Reuters [26] немецкая биотехнологическая компания «Artus GmbH» начала распространение разработанного ее сотрудниками экспресс-теста для диагностики ТОРС (SARS). Согласно заявлению представителей компании, на разработку этого теста ушло всего две недели. Разработанная «Artus GmbH» совместно с «Bernhard-Nocht Institute for Tropical Medicine» тест-система представляет собой комплект реагентов для проведения полимеразной цепной реакции для выявления РНК коронавируса, предположительно вызывающего ТОРС (SARS). В качестве объекта для диагностики может использоваться любой биологический материал – кровь, мокрота, кал, моча, мазки со слизистой носоглотки. Собственно процедура анализа занимает не более четырех часов, причем положительные результаты могут быть получены не через две недели после инфицирования, как в случае обычных иммунологических тестов, а практически сразу же после попадания вируса в ткани.

В настоящее время компания «Artus GmbH» бесплатно поставляет тест-комплекты в страны Азии, наиболее пострадавшие от вспышки SARS, а также в Австралию, США, Скандинавские страны и Германию, где были зарегистрированы отдельные случаи заболевания [26]

В течение последней недели ученые из Канады, Гонконга, Сингапура и Атланты в США сообщили о полном секвенировании генома ТОРС (SARS) вируса [11]. Исследователи надеются, что эти знания могут стать основой для разработки более чувствительных диагностикумов и даже терапевтических средств. В геноме SARS-вируса содержится более чем 29000 нуклеотидов. Имеющиеся ОТ-ПЦР-диагностикумы пока что детектируют только 200-500 из этих нуклеотидов. Остается определить, какая область генома может быть оптимальной мишенью для диагностического реагента. Это является сейчас основной задачей для исследователей.

Для того чтобы тест стал хорошим, прежде всего, необходимо усиление его биохимической специфичности. Это способ, когда используемые реагенты должны реагировать только с мишенями вируса. В случае ДНК-диагностического теста для SARS вирусных генов, нет сомнений, что специфичность имеется. Во-вторых, необходимо, чтобы тест был высокочувствительным. Используя современные ДНК-диагностические подходы, мы можем выявлять вплоть до 500-1000 частиц в миллилитре. Биохимическая специфичность и чувствительность является реально высокой и в настоящий момент может быть обеспечена. Однако трудности заключаются в особенностях вируса. Количество выделяемого вируса, фактически, может варьировать до 10000 раз у одного пациента и до миллиона раз между пациентами. Пока неясно, где и как вирус депонируется, но известно, что имеется небольшой промежуток времени, когда вирус может быть выявлен в различных жидкостях тела, прежде всего, в слюне, затем в крови и, в заключение, в стуле [27].

Согласно официальному отчету института Beijing Genomics Китайской академии наук SARS вирус очень быстро мутирует, поэтому необходимо тщательно изучить много штаммов, чтобы создать точные диагностические тесты и эффективные способы лечения [28]. Однако, по мнению американских исследователей в настоящее время не имеется очевидных данных, которые бы показывали, что SARS вирус быстро мутирует. По их мнению, коронавирусы обладают потенциалом изменяться больше, чем другие РНК-вирусы, главным образом, потому, что их геном значительно больше и высокая частота рекомбинации является их особенностью. Они считают, что рекомбинация, вероятно, ограничивается лишь обменом фрагментами генома с близкородственными вирусами. В случае с SARS-вирусом необходимо провести тщательный филогенетический анализ для определения того, приобрел ли этот вирус какую-нибудь генетическую информацию путем рекомбинации с хорошо известными коронавирусами животных [29].

Таким образом, имеющаяся на сегодняшний день информация по последним диагностическим разработкам и по динамике развития эпидемии вселяет определенную надежду на то, что борьба c вирусной SARS-инфекцией будет успешной. Ключевыми моментами здесь, конечно, стали достаточно быстрая идентификация возбудителя вновь возникшего заболевания, секвенирование его генома и принятие жестких противоэпидемических мер в странах-очагах. Главными задачами теперь являются использование полученных знаний для лучшего понимания самой инфекции, вызывающей ТОРС (SARS), для совершенствования диагностических тестов и для скорейшей разработки методов специфического лечения и профилактики этого заболевания.

Авторы выражают благодарность сотрудникам ГНЦ ВБ «Вектор» А.В.Миронову, В.А.Терновому, Н.А.Маркович за полезные замечания, техническую помощь и участие в сборе информации для данного обзора.

Список использованной литературы

1. Cumulative Number of Reported Probable Cases of Severe Acute Respiratory Syndrome (SARS). 2003. Сайт ВОЗ. http://www.who.int/csr/sarscountry/2003_04_26/en/

2. Epidemic curves - Severe Acute Respiratory Syndrome (SARS). 2003. Сайт ВОЗ.http://www.who.int/csr/sarsepicurve/epiindex/en/index1.html

3. Coronavirus never before seen in humans is the cause SARS. 2003. Сайт ВОЗ.http://www.who.int/1mediacentre/releases/2003/pr31/en/print.html 

4. PRO/EDR> SARS - worldwide (64): etiology 20030423.0996. Cайт ProMED-mail's International Society for Infectious Diseases. http://www.promedmail.org/pls/askus/f?p=2400:1202:98395027374564076::NO::F2400_P1202_CHECK_DISPLAY,F2400_P1202_PUB_MAIL_ID:X,21204 

5. PRO/EDR> SARS - worldwide (67): cases 20030424.1007. Cайт ProMED-mail's International Society for Infectious Diseases.http://www.promedmail.org/pls/askus/f?p=2400:1202:98395027374564076::NO::F2400_P1202_CHECK_DISPLAY,F2400_P1202_PUB_MAIL_ID:X,21386

6. Lai M.M.C., Holmes K.V. Coronaviridae : The viruses and their replication. Fields’ virology. vol.1. [ed. D. M. Knipe, P.M. Howley, D.E. Griffin.-4th ed,] 2001. Lip.Wil.&Wilkins. USA. p.1163.

7. Enterz. NC_002645; NC_001846; NC_003045; NC_001451.

8. Bellini W.J., Campagnoli R.P., Icenogle J.P. , et al. SARS coronavirus (SARS-CoV), Urbani strain. Unpublished. 2003. http://www.cdc.gov/ncidod/sars/pdf/nucleoseq.pdf 

9. SARS coronavirus, complete genome. Entrez . NC_004718

10. Qin, E., Zhu,Q., Yu,M., et al., 2003. GenBank. AY278487; AY278488 ; AY278489 ; AY278490; AY279354 .http://www.genomics.org.cn:8080/bgi/news/zhongxin/news030416-2_popmsg.htm 

11. Two SARS-associated viral genomes were sequenced in Beijing. 2003. http://www.genomics.org.cn:8080/bgi/news/zhongxin/news030416-2.htm ;

12. Drosten C. , Gunther S., Preiser W., et al.. Identification of a Novel Coronavirus in Patients with Severe Acute Respiratory Syndrome. //N. Engl. J. Med. 2003. www.nejm.orghttp://content.nejm.org/cgi/reprint/NEJMoa030747v2.pdf 

13. Ksiazek TG, Erdman D, Goldsmith CS et al. A Novel Coronavirus Associated with Severe Acute Respiratory Syndrome. // N.Engl.J.Med. 2003. www.nejm.orghttp://content.nejm.org/cgi/reprint/NEJMoa030781v3.pdf 

14. Peiris J S M, Lai S T, Poon L L M, et al. Coronavirus as a possible cause of severe acute respiratory syndrome. // THE LANCET • Published online. 2003. http://image.thelancet.com/extras/03art3477web.pdf 

15. Preliminary Clinical Description of Severe Acute Respiratory Syndrome.// MMWR Weekly. 2003. V.52. N12. P. 255-256. http://www.cdc.gov/mmwr/preview/mmwrhtml/mm5212a5.htm 

16. Clinical hold virtual conference on management of SARS patients. Сайт ВОЗ. 2003. www.who.int/csr/clinicansconference/en.print.html 

17. Hsu L-Y, Lee C-C, Green JA, et al. Severe acute respiratory syndrome (SARS) in Singapore: clinical features of index patient and initial contacts. // Emerg. Infect. Dis. [serial online] 2003.http://www.cdc.gov/ncidod/EID/vol9no6/03-0264.htm 

18. Updated Interim U.S. Case Definition of Severe Acute Respiratory Syndrome (SARS). 2003.http://www.cdc.gov/ncidod/sars/casedefinition.htm 

19. Atrasheuskaya A.V., Fredeking T.M., Ignatyev G.M. Changes in immune parameters and their correction in human cases of tick-borne encephalitis. // Clin. Exp.Immunol. 2003. V.131.P. 148-154.

20. Outbreak of Severe Acute Respiratory Syndrome -Worldwide, 2003. MMWR Weekly// 2003. V.52. N11. P. 226-228. http://www.cdc.gov/mmwr/preview/mmwrhtml/mm5211a5.htm 

21. HK Doctors Use Antibodies to Treat Pneumonia Victims. 2003. http://www.reuters.com/newsArticle.jhtml?type=scienceNews&storyID=2477221 

22. Case Definitions for Surveillance of Severe Acute Respiratory Syndrome (SARS). Сайт ВОЗ. 2003. http://www.who.int/csr/sars/casedefinition/en/

23. PCR primers for SARS developed by WHO Network Laboratories. 2003. Сайт ВОЗ.  http://www.who.int/csr/sars/primers/en/ 

24. Heymann D. L. Status of the global SARS outbreak and lessons for the immediate future. 2003. Сайт ВОЗ. http://www.who.int/csr/sarsarchive/2003_04_11/en/tests 

25. SARS: Availability and use of laboratory testing. 2003. Сайт ВОЗ.http://www.who.int/csr/sars/testing2003_04_18/en/ 

26. Blenkinsop P. German Firm Distributes First Sars Test Worldwide. 2003.http://www.nlm.nih.gov/medlineplus/news/fullstory_12350.html 

27. Testing for the SARS virus: hopes and realities //Strait Times Interactive. 2003.http://straitstimes.asis1.com.sg 

28. Progress in genome sequencing of Chinese isolates of SARS virus. 2003.http://www.gpbjournal.org/sars.jsp  

29. Shared mutations in the genomes of SARS coronaviruses. 2003.http://www.biomedcentral.com/news/20030416/04 






Comments